Info Teknologi » Teknik Produksi Benih Ubi Jalar Bebas Virus Menggunakan Kultur Meristem

Ubi jalar merupakan salah satu komoditas pangan target Gratieks (Gerakan Tiga Kali Lipat Ekspor) yang dicanangkan oleh Menteri Pertanian Republik Indonesia Dr. H. Syahrul Yasin Limpo, S.H., M.Si., M.H.. Permintaan ekspor ubi jalar terus mengalami peningkatan ditengah pandemi, baik dalam bentuk segar maupun olahan.

Penyediaan benih ubi jalar yang berkualitas (jelas identitas genetiknya, daya tumbuh baik, dan bebas hama penyakit) diperlukan untuk mendukung hasil ubi jalar yang sesuai pasar ekspor.

Perbanyakan benih ubi jalar yang dilakukan secara vegetatif menggunakan batang / sulur rentan terinfeksi oleh virus, sehingga menyebabkan virus terakumulasi dari generasi ke generasi, menyebabkan terjadinya penurunan viabilitas, produksi serta kualitas ubi jalar.

Teknologi kultur jaringan mempunyai prospek digunakan untuk perbanyakan cepat bahan tanam yang bebas hama dan penyakit (Tegen dan Muhammed 2016).

Gejala tanaman yang terinfeksi virus di lapang meliputi perubahan warna: bercak klorotik, mosaik, belang (mottle) berwarna ungu, perubahan bentuk (malformasi) daun, hambatan pertumbuhan (kerdil), dan daunnya berwarna kecoklatan.

Berdasarkan uji serologi dilaporkan terdapat enam jenis virus yang menyerang tanaman ubi jalar yaitu Sweetpotato Feathery Mottle Virus (SPFMV), Sweetpotato Mild Mottle Virus (SPMMV), Sweetpotato Chlorotic Fleck Virus (SPCFV), Sweetpotato Latent Potyvirus (SPLV), Sweetpotato Virus-6, dan Sweetpotato Virus-8 (Saleh et al. 2015).

Penyakit yang disebabkan virus menjadi lebih membahayakan karena menyebabkan penurunan hasil, kualitas, dan resistensinya terhadap serangga hama (Yang 2010). Penurunan hasil akibat serangan virus dilaporkan berkisar antara 65 – 72% (Daurov et al. 2018).

Gambar 1. Tanaman ubijalar yang terserang virus

Gambar 1. Tanaman ubijalar yang terserang virus

Produksi stek bebas virus diperlukan untuk menyediakan benih yang lebih baik kualitasnya. Salah satu teknologi yang dapat digunakan untuk menghasilkan benih ubi jalar bebas virus yaitu menggunakan kultur meristem secara in vitro.

Isolasi bagian meristem apikal, yaitu bagian tunas pucuk yang masih aktif membelah yang selanjutnya dikulturkan secara in vitro. Penggunaan tanaman bebas virus juga sangat dibutuhkan dalam konservasi plasma nutfah ubi jalar, sebagai upaya pelestariannya. Bagian meristem apikal yang digunakan untuk tanaman bebas virus seperti pada Gambar 2.

Gambar 2. Meristem apikal ubi jalar

Gambar 2. Meristem apikal ubi jalar

Langkah-langkah produksi benih ubijalar bebas virus secara in vitro diawali dengan penyiapan umbi, setelah disterilisasi kemudian ditumbuhkan tunas umbinya pada media tanah steril. Deteksi virus dapat dilakukan dengan metode Elisa.

Tanaman yang terdeteksi terserang virus selanjutnya dilakukan kultur meristem untuk memperoleh tanaman bebas virus. Tanaman yang bebas virus kemudian diperbanyak melalui kultur in vitro, seperti pada Gambar 3.

Gambar 3. Proses produksi tanaman bebas virus

Gambar 3. Proses produksi tanaman bebas virus


Persiapan Bahan Eksplan

Umbi hasil panen disterilisasi dengan cara dicuci dengan air mengalir dan direndam ke dalam larutan detergen cair konsentrasi 20 ml/l selama 30 menit, kemudian umbi direndam pada larutan fungisida dengan konsentrasi 2 g/l selama 30 menit.

Gambar 4. Pertumbuhan tunas umbi

Gambar 4. Pertumbuhan tunas umbi

Umbi dibilas dengan air steril kemudian dikering anginkan. Umbi yang sudah disterilkan diletakkan di bak/wadah dan ditempatkan dengan kondisi suhu kamar sampai muncul tunas. Umbi ubi jalar yang sudah tumbuh tunas kemudian dipindahkan ke media tanah steril, setelah tiga minggu tunas dapat digunakan sebagai bahan eksplan seperti pada Gambar 4 dan 5.

Gambar 5. Tunas umbi ditumbuhkan pada media tanah steril

Gambar 5. Tunas umbi ditumbuhkan pada media tanah steril


Pengujian Virus

Metode Deteksi Tanaman Indikator

Virus dideteksi dengan cara menularkannya secara fisik dari inang yang terinfeksi tanaman ke tanaman indikator yang sensitif terhadap virus. Contoh: grafting dengan Ipomoea setosa. Gejala serangan virus akan tampak pada tanaman yang diuji.

Metode ELISA

Uji serologi menggunakan Enzyme-Linked Immunosorbent Assay (ELISA), adanya reaksi enzimatic mengindikasikan adanya virus pada tanaman yang diuji. Reaksi warna yang dihasilkan oleh sampel yang diuji dibandingkan dengan kontrol (negatif).

Sampel yang menunjukkan reaksi positif dieliminasi. Metode estimasi visual tidak cukup efektif untuk mendeteksi semua tanaman yang terinfeksi, namun metode serologi (ELISA) dan tanaman indikator dapat mendeteksi virus dengan cepat dan akurat, sehingga telah menjadi protokol yang umum untuk deteksi virus.

Metode PCR

Analisis PCR dapat digunakan untuk mendeteksi ada / tidaknya virus tanaman ubi jalar yang berasal dari meristem apikal, primer yang dapat digunakan seperti pada Tabel 1.

Tabel 1. Primer yang digunakan analisis PCR, untuk deteksi virus SPFMV dan SPLV pada ubi jalar
Name Oligonucleotide
sequence of primers
Fragment
size (bp)
Annealing
Temperatur (t°)
SPFMV F TACACACTGCTAAAACTAGG
R AGTTCATCATAACCCCATGA
356 58
SPLV F GGAGTCAGTTCAATCAATGGTA
R AGTGGCTTTATTGGGTATGAT
184 60
(Daurov et al. 2018)

Isolasi Meristem Apikal Ubi Jalar

Tunas pucuk yang sedang aktif tumbuh dipotong, dicuci dengan air mengalir selama 30 menit, dan disterilkan dengan larutan natrium hipoklorit 2,5% selama 5-10 menit, kemudian di direndam alkohol 70% alkohol selama 3−5 detik, di dalam laminar.

Eksplan selanjutnya dicuci dengan air steril. Isolasi meristem apikal menggunakan scalpel dan jarum steril di bawah mikroskop. Isolasi meristem apikal (0,3 – 0,5 mm) dan transplanting ke media MS yang sudah diperkaya dengan kinetin 2,5 mg/l dan hormon GA3 0,5 mg/L (Alam et al. 2010).

Gambar 6. Perkembangan apikal meristem hingga menjadi planlet secara in vitro (Alam et al. 2012). (A) Perkembangan apikal meristem (6 HST) pada media cair; (B) Pucuk dengan perkembangan daun primer setelah sub kultur pada media semi padat; (C) Pucuk dengan perkembangan daun primer setelah sub kultur pada media semi padat; (D) Perbanyakan planlet;

Gambar 6. Perkembangan apikal meristem hingga menjadi planlet secara in vitro (Alam et al. 2012). (A) Perkembangan apikal meristem (6 HST) pada media cair; (B) Pucuk dengan perkembangan daun primer setelah sub kultur pada media semi padat; (C) Pucuk dengan perkembangan daun primer setelah sub kultur pada media semi padat; (D) Perbanyakan planlet;

Selanjutnya meristem apikal yang diinokulasi terbentuk kalus, pada medium yang sama, 2 bulan kemudian, terbentuk tanaman dari kalus (Gambar 6).


Aklimatisasi


Planlet tanaman ubi jalar hasil perbanyakan dari meristem apikal dapat diaklimatisasi ke pot yang telah berisi media tanah : pasir : kompos dengan perbandingan 1:2:1, diletakkan di rumah kaca.

Febria Cahya Indriani


Daftar Pustaka

  • Alam, I., S.A. Sharmin. 2012. Elimination and detection of viruses in meristem-derived planlets of sweetpotato as a low-cost option toward commercialization. 3 Biotech. Springer. DOI 10.1007/s13205-012-0080-6.
  • Dourov D., K. Zhapar, A. Daurova, D. Volkov, M. Bakbergenova, D.Tolegenova, M. Shamekova and K. Zhambakin. 2018. Production of virus-free sweetpotato planting material for the Southeast of Kazakhstan. International Journal of Agriculture and Biology 20(4): 851-856.
  • Saleh, N., S.W.Indiati,Y.Widodo, Sumartini, St.A. Rahayuningsih. 2015. Hama, Penyakit, dan Gulma pada Tanaman Ubijalar. Identihikasi dan pengendaliannya. Pusat Penelitian dan Pengembangan Tanaman Pangan. Badan Penelitian dan Pengembangan Pertanian. 80 hal.
  • Yang, X., 2010. Rapid production of virus-free planlets by shoot tip culture in vitro of purple-coloured sweetpotato (Ipomoea batatas (L.) Lam.). Pakistan Journal of Botany 42(3): 2069-2075.
  • Tegen, H., W. Muhammed. 2016. The role of plant tissue culture to supply disease free planting materials of major horticultural crops in Ethiopia. Journal of Biology, Agriculture and Healthcare 6(1): 122-129.